Evolution Biol 4802

Lecture 11

 

Topics for today

The origin of genetic variation

    1. Where does it come from?
    2. How quickly does it arise?
    3. What impact does it have on organisms?

I assume you know these terms

  1. Genome
  2. Locus
  3. Gene
  4. Intron and exon
  5. Allele
  6. Polymorphic vs. fixed
  7. Homozygous v. heterozygous

In what context have we talked about mutation so far?

1.      Some mutations distinguish species and can be used to build phylogenies

2.      Mutations sometimes occur at rate that is constant enough to use it as a clock

What is the significance mutation within species?

  1. Fuel of change
  2. Produces genetic variation essential for adaptation

How much genetic variation is there within a single human being?

  1. The Diploid Genome Sequence of an Individual Human (Levy et al. 2007, on web)
    1. 99.5% similarity between chromosome pair
    2. 4.1 million differences across the 3.2 billion bp in genome
    3. 5 x more differences than previously estimated
    4. 44% of genes were heterozygous
    5. Majority are single nucleotide polymorphism (SNPs)
    6. 22% were insertions and deletions (accounts for 74% of variation)

What are mutations?

  1. Alterations in chromosomes or genes (process & outcome)
  2. Errors
    1. Most happen during DNA replication
    2. Chemical and physical damage
    3. Some repaired, some not
  3. Transmitted to the next generation?
    1. Somatic cell

                                                               i.      animals – no

                                                             ii.      plants – can happen

    1. Germ cell

                                                               i.      transmitted in both plants and animals

                                                             ii.      5x more new mutations via sperm than eggs because there are more cell divisions prior to spermatogenesis

Do these genetic differences matter?

  1. Born with at least 300 new mutations that make our DNA different than our parents
  2. One or two probably have negative effects
    1. Rapidly eliminated
  3. Some are positive
    1. Fixed and considered the “wild type”
  4. Most are neutral
    1. Change in frequency according to random processes (drift)
  5. Most DNA has no apparent function
    1. < 5 % of human genome encodes proteins
    2. 45 % is repeat sequences

                                                               i.      Microsatellites

1.      Few bp repeats (CATCATCATCATCATCATCAT)

2.      Up to 2 billion within a species

3.      Can be used to distinguish individuals in a population

    1. Transposable elements move around the genome

                                                               i.      Can carry other functional genes along

  1. DNA transposon – encodes gene that facilitates movement
  2. Retroelements – includes reverse transcriptase (RT) that transcribes RNA into DNA which is inserted into the genome

Effects of transposition

  1. Insertion into coding region usually destroys function through frame-shift mutation
  2. Insertion in control regions interferes with gene expression
  3. Causes deletions
  4. Causes inversions
  5. Bulks up the genome size

Do transposable elements influence variation in traits?

  1. Completely homozygous lines
  2. Chromosome 2 or 3 is “balanced” with a wild type chromosome
  3. Introduction of transposable elements increased variation

Does additional DNA represent a greater evolutionary opportunity?

  1. Not necessarily - Genome size is not related to organismal complexity
  2. But is it all “junk DNA?”

What happens to a functional gene that is duplicated?

  1. Mutates to the point where not functional = pseudogene
  2. Undergoes mutation and selection to acquire new function
  3. Can produce gene families
  4. Phylogeny of homologous genes within a genome

How fast do mutations accumulate?

  1. Candidate genes
    1. Rare mutation in human FOXP2 gene causes severe speech and language disorders