Nicotinamide nucleotide transhydrogenase Contig

 

>Contig_1 (1,2138)

GTCGGGCTTGTGCTGTGTTGGTGCCCTGGCTGGCCTTTCCACCCAGGGAACAGCTNGTCTTGGCAATGCATTGGGTATG

ATTGGGGTTGCTGGAGGCCTGGCAGCCACACTTGGAGGCTTAAAACCGGACCCAGAATTGTTAGCTCAGATGTCTGGAG

CAATGGCTTTGGGCGGTACCATTGGATTGACAATTGCCAAACGCATCCAGATTTCCGATTTACCTCAGTTAGTTGCTGC

TTTCCACAGTTTAGTGGGCTTGGCAGCCGTGTTGACTTGCATAGCTGAGTACGTTGTGGAATATCCACATTTTGCTATG

GACGCAGCAGCAAATCTCACCAAGATCGTGGCCTACCTTGGCACTTACATTGGCGGTGTCACCTTCAGTGGGTCACTTG

TGGCCTATGGGAAATTACAGGGTATCCTGAAATCAGCCCCTCTCCTTCTACCTGGAAGGCACTTACTCAATGCAGGCTT

GCTGGCTGCTAGTGTCGGTGGAATAATCCCGTATATGATTGACCCCAGCTTTACCACTGGCATTACCTGTCTGGGCTCC

GTGTCAGCTCTTTCTGCTATCATGGGTGTGACCCTGACGGCTGCCATCGGGGGTGCCGACATGCCCGTCGTCATCACTG

TGCTGAACAGCTACTCGGGCTGGGCTCTCTGTGCAGAGGGATTCCTGCTCaACAATAACCTGCTCACCATCGTGGGCGC

GCTCATCGGATCCTCTGGGGCTATCCTGTCCTACATCATGTGTGTGGCAATGAATCGCTCCCTGGCTAATGTGnATTCT

TGGAGGCTaTGGTACCACTTCAACAGCTGGTGGGAAACCCATGGAAATTTCTGGCACACATACAGAAATCAACCTTGAT

AATGCCATCGACATGATTCGAGAAGCTAATAGCATTATCATTACTCCAGGATATGGTCTCTGTGCAGCCAAAGCTCAGT

ACCCCATTGCTGATTTGGTAAAGATGCTCACGGAGCAAGGCAAAAAAGTCAGGTTTGGAATTCACCCAGTTGCAGGCCG

AATGCCTGGCCAGCTTAATGTGCTGCTGGCTGAGGCTGGGGTGCCATATGATATTGTGTTGGAAATGGATGAGATCAAC

CATGATTTCCCAGACACTGATTTGGTCCTTGTAATTGGAGCTAATGACACTGTTAATTCAGCAGCTCAGGAAGATCCCA

ACTCTATTATTGCAGGCATGCCAGTCCTTGAGGTCTGGAAATCAAAGCAGGTCATTGTCATGAAGAGGTCTCTGGGTGT

TGGCTACGCTGCAGTGGACAATCCAATCTTCTACAAACCCAACACAGCCATGCTTCTAGGTGATGCCAAGAAGACATGT

GATGCGCTGCAGGCAAAASTTAGAGAATCCTACCAGAAGTAAATATCAAAGCCCAAGTCAGTATCTGATGAGGTTGCTG

CtTTCGAGCTATAGGAACAGGCAGAAAGCATCAGTGTTTGTGGCTGATCCACATCTGTAGCAAAGCTCTTGGAAGAAAA

GGAAGACTGAAGAAAGCCAAGAAGATAGAGGGATATTTTTCAAGAGCAGTGATCCTTCCATTTTATAAAAAAGATTGAA

AATTTTGAATGTTTATCTGTGCATAATTTTTTTGGGGCAAAAGAATTTTATAAAAGGAGAAAGAATAACCTCATTTTCG

ATATAATTCCGCTGGATTTTTAAATTCCCCTTCTGTAACCAAGAATGTTTTCAGAAGTTGAATGTTTAGGATTTCAGGA

CCTAAAATTTGTTTGGGTCTAAAAAATACAACACAATGTAAACATTGCAAATACCTGCATTTTTGTTTTCTCAGCAGAT

GTGACTAATTTGAAACTTTTGTCAGTTCCTAAGCTGTCCCATTGCATTTTAACCATAGTTTGAATTGATCTCATTAAAT

CTGTCTTAAGTTTTCAAACTGTACTTCAGATTCCAGATTTTAGCAGTATATTTTTCTCACTTCTATTTTGATACATTAA

AGGACTATATAATCTTTTTGAGATGCTGGAAACAAATTATGTGCTTTTCTATGTTCAATGAAACCACTTGNAANTAACA

TTAGTATTTTTTGAAAACCCCATTTCCNATTGGGAAATCTCTTTAATTTCNATNCAATTTTAGTACTGTATTAAGTGCA

CTTGG