Woodchuck hepatitis virus DNA Contig

 

>Contig_2 (1,932)

GAACTTATTCTTTTTTTAATATTTATTTTTTAGTTTTCGGTGGACACAACATTTTTGTTTGTATGTGGTGCTGAGGATC

GAACCCAGGCAGCACGCATGCTAGGCGAGCGCCGCTACCACTTGAGCCACATCCCCAGCCCCGAGAACTTATTCTTCTT

GCAGAATTTAGGAGACAATATTACTTAACATCTCTGTACAATATTACTTAACATCTCAGTCCTATAATAGAATTGCCTA

TGATAATTCTATCATAGGATTCTTTTAATAATCTTTTTTTTTTTTAAAGAGAGAGTGAGAGGGGAGAGAGAGAGAKWYW

GAGAGAGAGAATTTTWncAWTtATTTATTTTTTYTTAGTTCTCGGCGGACACAACATCTTTGTTGGTATGTGGTGCTGC

TGAGGATCGAACCCGGGCCGCACGCATGCTAGGCGAGCGCGCTACCGCTTGAGCCACATCCCAGCCCCCAGGGCTTATC

TTTAATAGAAGAGGAATAATGATAATACTCAGGATTATTTTGAGCATGCACATAAAACAGATTTTAGCAGATAAATGTT

AAGAAAATGGGCTATTACTACTGTTAATGTGATATAACGGTAACATATACAAGTCAGGCAAGACATTATTAGACAATGA

ACCTCAACCCAGACTTCCTGGGTTCTCACTGATGACTAAACTGTGCATTGCTTGGTGACTTCCAGTAATTTCTTTCTTC

ACTTTGCTGGAACTCTGACCTGAGGTTGACCTTAAGGCTCCTTGTTCATCTGTAACAACAGGAACTGCTTCTTTCCCCT

TTTCTCCCTTTAGAAGACTGTCAAGAAGGAGCCTGAGGGAGGAAGGTGGATCAACCATGGTCTTGGAGAAAAGGAAGTA

GACTCTCTACCCCTTCTTAGTTTTTTTCTGCCATGGGCTGCGGACGTCTTGTCTTAAATAAAG