ncx1 gene (exon 12) Contig 1

 

>Contig_1 (1,1124)

CTTTCTTTTCACCTGAGTTGTTGCTTTCATGTTGTTATTGAGTTTGATTATTACTAGGGATAAAAGGAGAAAAATGGCT

CATTTTTTCATGCACATTCATTCTAAGAAGCAATAACAGTCTTGTGGGGAAAAGCTAAAGTTTTTGAGAGGCTAGCAGG

CAACTTACAAAGATCTTTATGGAAAATTAGCCACGTGGAACATATCGGAGGCCTCTGTGAATCACCCATTAATTCAGGA

AGGCCAAAGAGAAAGGTGTTGGAGAGAAGTGAATACGTGGGATATGCCTGGCTTTCAGAACCACCATGTCCACAACACC

CCTTCCCCCAAAGTATTTATTGCACATCTGCTCTGTCTGGCACAGATGTTAGATGGCACTGGTCTGTTCATTTTATTTT

TTTATGTAAAAGGCATTATTGAGTCCTGTTTCTTTCACCATCCAGtccaGACTCCTCTGATTATATCAGTAGTTCCCAA

GTAGGAAAGAAGCCAAGATAACCAATGGGCCTTTAAGTGTTTCTCCTCTACTTATGATGAAAAGAAGGTAATTAAATGA

GATTCGTGTCTCCCAGAGGATTGCACTGGGAGGTTTTAACCCTTGAAAAGGAATGGCTCTTTCTATTTCAAAAtACCAA

AGAGTGTAGATCAACCCAACATTCCAAAAAGTGATTCCACTAATGAGTAAAATTGGAATGACTGTTCACCTCTCARAGA

CTTCTCAGTCTCTTAAGGAAATCCAGGCCGGAGACATCCCTGGCCCTCTGTnATtCATTCMAAGATacCAAAAAAAAgA

AACATTGGTGAGGBCTATTTtCTCTTCCTCTACTCmgAgAATCATGACCATTCACCATTTTATTAAAATGCTTGGTGAT

GGAGTAAAATAATGAAATGCTGGTCGTCCACTCACCAGGCCAGGTAGAATACTGTTTTCCTGGGGCCCAAGGCATGACC

AAGGCAGCCCAGCTTCCTGCCTCAGCAGGGTNCNCAGAGAATCCAATTACCCTTTTCCCCGAGTTAAAAGTTAACNCAA

NCCCTNTNGGGAACNGTTTTTATTCTTGGCCAAGGNTGGAACCCCAATTTTTGAAAAATGGTTTNAATTTTGAACCCCC

TTAATTTGN