ncx1 gene (exon 12) Contig 2

 

>Contig_2 (1,854)

GGATGAACACAATTATGAAAATGTTTAATTTGAACACATAATTGTACAGATAAAATTGTACTCAARKAKcAMASATgTR

TCTKYAAGWWGatGYMAAGYWTAgAKttGARGRWSWCYCtCCYTaTgCTTGGYYtAAMWTGGGGAGACACATGTATCTG

CAAGTTGGCCAAGCAgggcawTcATgtGGTGATGCACATCACTGAGCAGACCCAGTTAACCTCAGTTTTTACCATTGTG

GCAACAGTACTTTTCCAGGACCCATCTCTGACCTGTCATTGACAACCAACACTGGTGACTGCTATAGGGACACATTCTA

ACCCACTCCCCACCCCCCAACCAAGATTTAAAAAATGGAAAGCTAGCCTAGAAACACCAAGTAAATAAGGGAAGGGATA

CAGGTATTTAAACTTTAGAAAGATTTTGCACTCATTTCTAGCCATATTTGGAATGTCAGTAACCCCTTAGTGAATCTTC

ACTTTAAAAGAACCCTTAAGAAATTCTTGCTGTTGGTGGATTTCAATTTTGAAACATTTTGGTTTGTTTGCCTTTTCAG

TTTTCATGCTATAGAGAAAATACGATTCTCATTATTCAGGGTTGTTATTATTATAGTTGTGTAAAATTATTTCATTTGA

TTTGTTTGATTATTTTATTTTGTGTGTATTGTGCACAGCTTTAGGGGGGAAATGCACTAATTGTGCTGgTTCCTTATAA

ATGGTACACATATTGACACAGACCAATAAAGgTTCcTAATTGGTTCTGATTTAATCACTAGTGATAAAAAAAAAWMWRA

ATGcaGGGGTTTCTCTCTTCNCATTGGCATTGGACTTCATCTTTTTGGGTTTCNTGG